circad | circRNAs associated with diseases

mmu_circRNA_008758
Gene	n/a	Organism	Mouse
Genome Locus	n/a	Build	n/a
Disease	Nonalcoholic steatohepatitis	ICD-10	Other specified inflammatory liver diseases (K75.8)
DBLink	Link to database	PMID	27677588
Experimental Method
Sample Type	Liver Tissues	Comparison	nonalcoholic steatohepatitis (NASH) (n=12) and control (n=12)
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AGAGGCTAGCAGTGGTCATTGTC Reverse TCGCGGGGCAACCTTTTCC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Jin, X, Feng, CY, Xiang, Z, Chen, YP, Li, YM (2016). CircRNA expression pattern and circRNA-miRNA-mRNA network in the pathogenesis of nonalcoholic steatohepatitis. Oncotarget, 7, 41:66455-66467.