Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
mmu_circRNA_008758 | |||
Gene | n/a | Organism | Mouse |
Genome Locus | n/a | Build | n/a |
Disease | Nonalcoholic steatohepatitis | ICD-10 | Other specified inflammatory liver diseases (K75.8) |
DBLink | Link to database | PMID | 27677588 |
Experimental Method | |||
Sample Type | Liver Tissues | Comparison | nonalcoholic steatohepatitis (NASH) (n=12) and control (n=12) |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward AGAGGCTAGCAGTGGTCATTGTC ReverseTCGCGGGGCAACCTTTTCC | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Jin, X, Feng, CY, Xiang, Z, Chen, YP, Li, YM (2016). CircRNA expression pattern and circRNA-miRNA-mRNA network in the pathogenesis of nonalcoholic steatohepatitis. Oncotarget, 7, 41:66455-66467. |